Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_104871 | |||
Gene | n/a | Organism | Human |
Genome Locus | n/a | Build | hg19 |
Disease | Rheumatoid Arthritis | ICD-10 | Rheumatoid arthritis, unspecified (M06.9) |
DBLink | Link to database | PMID | 28618429 |
Experimental Method | |||
Sample Type | Peripheral Blood Mononuclear Cells (PBMCs) | Comparison | Peripheral Blood Mononuclear Cells (PBMCs) from 5 Rheumatoid Arthritis (RA) patients and 5 healthy controls |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward CGGAACTTCCTGTGGTCATCT ReverseTCCATCTCAAGCAGGTACATT | Statistics | Fold Change : Upregulated,1.536 pvalue : p=0.037 |
Citation | |||
Ouyang, Q, Wu, J, Jiang, Z, Zhao, J, Wang, R, Lou, A, Zhu, D, Shi, GP, Yang, M (2017). Microarray Expression Profile of Circular RNAs in Peripheral Blood Mononuclear Cells from Rheumatoid Arthritis Patients. Cell. Physiol. Biochem., 42, 2:651-659. |